422 another two level sum of products circuit a and or b and or with extra

Báo cáo khoa học: "A FLEXIBLE NATURAL LANGUAGE PARSER BASED ON A TWO-LEVEL REPRESENTATION OF SYNTAX" ppt

... theory of formal languages a l a n guage is defined as a set of strings; for this reason ATNs must recognize Uordered sequences" of symbols (or words) Of course also the natural lan guages have ... IJCAI, Vancouver B. C (198 1a) , 440-442 Lesmo L., Magnani D., Torasso P.: Lexical and Pra~ matic Knowledge for Natural Language Analysis Proc IEEE Int.Conf on Cybernetics and Society, Atlanta GA ... sentence is a potential garden path in a psych~ logically plausible way The semantic knowledge plays a fundamental role in choosing a particular analysis Milne argues that a one-word lookahead, with...

Báo cáo khoa học: "Two-level Description of Turkish Morphology " docx

Danh mục: Báo cáo khoa học

...

Báo cáo hóa học: " Research Article Remarks on Sum of Products of h, q -Twisted Euler Polynomials and Numbers" potx

Danh mục: Báo cáo khoa học

... Jang, H K Pak, S.-H Rim, and D.-W Park, A note on analogue of Euler and Bernoulli numbers,” JP Journal of Algebra, Number Theory and Applications, vol 3, no 3, pp 461–469, 2003 18 L Comtet, Advanced ... q-integral on Zp at q −1,” Journal of Mathematical Analysis and Applications, vol 331, no 2, pp 779–792, 2007 T Kim, “On the q-extension of Euler and Genocchi numbers,” Journal of Mathematical Analysis ... polynomials associated with basic q − lfunctions,” Journal of Mathematical Analysis and Applications, vol 336, no 1, pp 738–744, 2007 13 T Kim, “Sums of products of q-Bernoulli numbers,” Archiv der Mathematik,...

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Danh mục: Báo cáo khoa học

... proteins migrated as major bands of 50 kDa After Factor X or thrombin cleavage and removal of GST the I domains appeared as single major bands of approximately 24 kDa (CD1 1a) and 26 kDa (CD1 1b) The ... (B- T1), and anti-ICAM-4 (BS46) followed by FITC-rabbit antimouse IgG F(ab¢)2 fragments and were analyzed by ﬂow cytometry (B) Cell adhesion of parental L cells and ICAM transfectants to CD1 1a/ CD18, ... domains of CD1 1a and CD1 1b Our results indicate that Mg2+ or Mn2+, but not Ca2+ are necessary for the interaction of CD1 1a I domain with ICAM-1 and ICAM-2 transfectants and for the CD1 1b I domain binding...

System level modeling of endothelial permeability pathway and high throughput data analysis for disease biomarker selection

Danh mục: Thạc sĩ - Cao học

... are more appropriate PDEs can account for state variable that change temporally and spatially These equations may be appropriate for describing the structural changes in the self-organization biological ... understand better about the pathway components and gives us ideas about the behavior of the various interactions involved in the pathway Pathway simulation has been an important topic in Systems Biology ... the obtained image is processed, transformed and normalized And the analysis, such as differentially expressed gene identification, classification of disease/normal status, and pathway analysis,...

Báo cáo khoa học: Characterization of rat cathepsin E and mutants with changed active-site residues and lacking propeptides and N-glycosylation, expressed in human embryonic kidney 293T cells ppt

Danh mục: Báo cáo khoa học

... Jose, CA, USA) Vectashield was from Vector Laboratory Inc (Burlingame, CA, USA) Antibodies to Bip (GRP 78) and Lamp1 were from Stressgen Bioreagents (Victoria, BC, Canada) Antibodies to rat cathepsin ... cleavage is mediated by a vacuolar ATPase that generate an acidic pH in the trans-Golgi network J Biol Chem 269, 22875–22881 Athauda SBP, Takahashi T, Kageyama T & Takahashi K (1991) Autocatalytic ... microglia J Biol Chem 277, 4816–4822 37 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant...

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Danh mục: Báo cáo khoa học

... activation of various Hsp90 clients and Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a and Hsp9 0b Whether Hsp9 0a or ... ampliﬁcation of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT (PstI ... Hsp90s but 5¢ homologies to plasmid pBDC [34] (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer...

Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its ﬂexible C-tail pdf

Danh mục: Báo cáo khoa học

... GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by thrombin and Fx proteases at an NdeI site behind the Histag Apamin folds ... FEBS I Karbat et al conformations between the two populations would involve the formation and breakdown of hydrogen bonds and changes in the tilt and twist angles of the backbone, and should be sensitive ... mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and their mutants...

Báo cáo khoa học: Domains of ERRcthat mediate homodimerization and interaction with factors stimulating DNA binding potx

Danh mục: Báo cáo khoa học

... 5¢-AGT CGACTCACATGTGCTGGCCAGCCTCGTAATC-3¢ (ERRc-408), D82 5¢-AGTCGACTCAATTAGCAAGAG CTATTGCTTT-3¢ (ERRc-376), D127 5¢-AGTCGA CTCATATATAATCGTCTGCATAGAC-3¢ (ERRc331), D173 5¢-AGTCGACTCAATGTTTTGCCCATCCA ... GCNF-start 5¢-ACCATGGAGCGGGACGAACGGCC ACCTAGC-3¢, c2-stop, G2r 5¢-AGTCGACTTCTTCT TCTGATATCTGGACTGG-3¢(GCNF 1–167), E2f 5¢AGTCGACAGAATAGATGCTGAGAACAGCCCA-3¢ (ERRc 213–458), G3r 5¢-AGTCGACCAGACTGTAG ... GenBank accession number AF117254) For the C-terminal truncations the start primer c2-VSVG-start (5¢-ACCATGGAGTACACCGACATCG AGATGAACAGGCTGGGCAAGGATTCGGTAGAA CTTTGCCTGCCT-3¢ that includes a translational...

Nanoscale metal-organic frameworks synthesis and application of bimodal micromeso-structure and nanocrystals with controlled size and shape

Danh mục: Tiến sĩ

... important new class of porous inorganicorganic hybrid solids with the potential for a significant impact on separation, gas storage, catalysis and biomedicine These materials are formed by assembly ... together via a central bridging O atom and each pair of the octahedral metal atoms is bridged by two carboxylate groups Each metal ion coordinates to a terminal ligand such as solvent or anion The ... and the ability to tailor the pore cavity environment.69,70 The extraordinary degree of variability for both organic linkers and metal-containing SBUs leads to tunable properties that make MOFs...

Báo cáo y học: ": Significant improvements in self-reported gastrointestinal tolerability, quality of life, patient satisfaction, and adherence with lopinavir/ritonavir tablet formulation compared with soft gel capsules" docx

Danh mục: Báo cáo khoa học

... Cmax and AUC The tablet formulation is also significantly more bioavailable than the SGC formulation when taken in a fasted state, which allows the flexibility to dose LPV/r tablets with or without ... evaluated in Abbott Study 730 Similar rates of moderate or severe diarrhea, nausea, and vomiting were observed for males and females [16] Abbott Study 730 also evaluated the safety of LPV/r tablets ... sodes of diarrhea, nausea, and bloating/gas with the tablet formulation compared with 0%, 8% and 6%, respectively, with the SGC formulation The need for antidiarrheal medications was decreased;...

Báo cáo y học: "Circulating retinol binding protein 4 in critically ill patients before specific treatment: prognostic impact and correlation with organ function, metabolism and inflammation" pot

Danh mục: Báo cáo khoa học

... 24-68 years) who had normal blood counts, normal liver enzymes and normal C-reactive protein levels served as controls Comparative and laboratory variables The ICU patients were compared by age, ... obtained at admission and the simplified acute physiology score (SAPS) [16] Laboratory parameters were routinely assessed at admission, recorded and analyzed Quantification of RBP4 serum levels and ... patients with sepsis had a higher ICU and overall mortality as well as significantly longer ventilation duration (Table 2) RBP4 serum levels are associated with liver and renal function and are...

Orderflow, type of trader, public information and relation with volatility

Danh mục: Cao đẳng - Đại học

... the availability of trades and quotes data which are from NYSE TAQ database Stock returns are retrieved from CRSP database Accounting numbers are obtained from COMPUSTAT North America database ... dummies are replaced by sub-period dummies All the explanatory variables, except for dummy variables, are calculated as the average values of the corresponding yearly variables within each sub-period ... quotes and transaction data in that year to obtain its yearly measure of PRIVATE_INFO, PUBLIC_INFO and NOISE 19 2.3 Relation between idiosyncratic volatility and private information, public information...

Interaction of environmental calcium phosphate and ph with glass ionomer restoratives

Danh mục: Cao đẳng - Đại học

... translating to clinical applications 2.3.1 Saliva Saliva is the primary constituente of intra-oral chemical environment As natural saliva is varied/unstable and more than 90% of saliva is water, ... 119 Table 7-1 pH of storage media after weeks 128 Table 7-2 Ion / ligand release by FN 132 Table 7-3 Statistical comparison of ion/ligand released by FN between acidic storage media 132 Table ... significant influence on glass-ionomer restoratives In a clinical survey for causes of restoration failure, the ranking of failure factors was in decreasing order of patient, operator and material factors...

The expression of CD44s in squamous cell carcinoma of the oral tongue and association with clinicopathological factors and survival outcomes

Danh mục: Cao đẳng - Đại học

... carcinoma CHAPTER INTRODUCTION 1.1 Head and Neck Cancers Squamous cell carcinomas of the head and neck (HNSCC) are epithelial malignancies that arise from the paranasal sinuses, oral cavity, oropharynx ... in anti-apoptosis and resistance to chemotherapeutics.56, 57 The abberant activation of epithelial-mesenchymal transition (EMT) facilitates metastasis by breakdown of cell-cell and cell-extracellular ... from all head and neck subsites except the nasopharynx and salivary glands were included Patients who met the above criteria had been randomized into the two treatment arms: the standard (S) arm...

Dual activation of estrogen receptor a and aryl hydrocarbon receptor by the prenylflavone, icaritin restrict breast cancer cell growth and destabilize estrogen receptor a protein

Danh mục: Tổng hợp

... availability of therapies targeting estrogen and growth factor signaling pathways, the incidence and mortality of breast cancers have not decline at the same rate as other major causes of death, ... friendship and assistance Their presence made the laboratory an enjoyable place to work in Many special thanks to my family members and friends for their constant support and encouragement Above all, to ... microarray data analysis I am greatly appreciative of all the laboratory members (Vanessa, Faisal, Eileen, Dr Shijun, Gaik Hong and Seok Eng) who have generously extended their warm friendship and...

Báo cáo hóa học: " Research Article Performance of a Two-Level Call Admission Control Scheme for DS-CDMA Wireless Networks" potx

Danh mục: Báo cáo khoa học

... downlink bandwidth ratio and bandwidth reservation ratio parameters on the system performance metrics of call blocking, outage probability, average throughput achieved for both class (real-time) and ... 0.5 Ratio of reservation bandwidth to total bandwidth (Wres /W) Class new call Class handoff call Class call Figure 5: Call blocking probabilities versus reservation bandwidth ratio higher bandwidth ... by one of the following events: (1) arrival of a class new call, (2) arrival of a class handoff call from a neighboring cell, (3) departure (handoff) of a class call to a neighboring cell, and (4)...

Báo cáo toán học: "Linear Recurrence Relations for Sums of Products of Two Terms" ppt

Danh mục: Báo cáo khoa học

... for all m, n ≥ By a similar argument as above, we prove most of the identities in [1] We always take F to be a binomial coefficient which satisfies a triangular recurrence relation As another example, ... identities of sums involving special combinatorial sequences We first split the summand into a product of two terms F (n, k) and G(n, k) so that F (n, k) depends on as few variables as possible and satisfies ... Graham, D.E Knuth, and O Patashnik, Concrete Mathematics: A Foundation for Computer Science, Addison-Wesley, Reading, Massachusetts, 1989 [8] M Kauers, Summation algorithms for Stirling number...

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Danh mục: Y học thưởng thức

... mg) to achieve maximal vasodilatation before undergoing their initial and final angiograms The glycoprotein IIb/IIIa inhibitor (Tirofiban) was administered at the operator’s discretion All patients ... subacute, to 30 days; late, >30 days and very late, >1 year) Myocardial infarction was defined as a creatine kinase (CK) elevation >2 times above the upper limit of normal levels with any associated ... SPSS for Windows (version 10.0, Chicago, USA) Continuous variables were described as mean ± standard deviation (SD), and categorical variables were reported as percentages or proportions Comparison...

Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis

Danh mục: Y học thưởng thức

... the band with molecular weight around 4.5 kilo base pairs detected by cIAP2 probe was expected as the cIAP1 RNA (Figure 1B, the band below cIAP2 band) The nature of the third band below cIAP1 ... up-regulation of cIAP2 was confirmed by the Northern Blot analysis After the hybridization with the probe specifying cIAP2, cIAP2 RNA appeared as a special band located in the place with the molecular ... caught by RNA binding spin cup After washing, DNA was degraded by the digestion of DNase Finally RNA was released from cup and stored in –70° C for use Micro-array analysis For gene array analysis,...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25

422 another two level sum of products circuit a and or b and or with extra inverter

422 another two level sum of products circuit a and or b and or with extra inverter